View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_116 (Length: 205)
Name: NF0493_low_116
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_low_116 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 57 - 190
Target Start/End: Complemental strand, 54775 - 54642
Alignment:
| Q |
57 |
ccatagattacatttcaatattattagctagatagattacatgatggaacatgcatttacattgtcatcgttaaaaagggagacaagtaattcttcttga |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54775 |
ccatagattacatttcaatattattagctagatagattacatgatggaacatgcatttacattgtcatcgttaaaaagggagacaagtaattcttcttga |
54676 |
T |
 |
| Q |
157 |
tgattggatgaggccataggggcagcctgcacaa |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
54675 |
tgattggatgaggccataggggcagcctgcacaa |
54642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University