View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_117 (Length: 204)
Name: NF0493_low_117
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_low_117 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 3e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 29285313 - 29285189
Alignment:
| Q |
1 |
agggaaaacggaaacaccaaaaaacttatgaatagtgctgcattatgtaagttcaacatctccaatgacaggaatattttcaaattacccccttgtaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29285313 |
agggaaaacggaaacaccaaaaaacttatgaatagtgctgcattatataagttcaacatctccaatgacaggaatattttcaaattacccccttgtaaaa |
29285214 |
T |
|
| Q |
101 |
actaaaaactccatcgccattttct |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
29285213 |
actaaaaactccatcgccattttct |
29285189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 3 - 123
Target Start/End: Complemental strand, 35233216 - 35233096
Alignment:
| Q |
3 |
ggaaaacggaaacaccaaaaaacttatgaatagtgctgcattatgtaagttcaacatctccaatgacaggaatattttcaaattacccccttgtaaaaac |
102 |
Q |
| |
|
||||||||||| |||||| ||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35233216 |
ggaaaacggaagcaccaacaaatttatgaaacgcgctgcattatgtaagttcaacatctccaatgacaggaatattttcaaattacccccttgtaaaaac |
35233117 |
T |
|
| Q |
103 |
taaaaactccatcgccatttt |
123 |
Q |
| |
|
||||| | |||||||||||| |
|
|
| T |
35233116 |
aaaaaatttcatcgccatttt |
35233096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 167 times since January 2019
Visitors: 3464