View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_119 (Length: 203)
Name: NF0493_low_119
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_low_119 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 29285289 - 29285393
Alignment:
Q |
1 |
gttttttggtgtttccgttttccctcacaacatttcaatatacagacacttattttatggttggtcgttagctattctgtccaagtttgttggatgagta |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29285289 |
gttttttggtgtttccgttttccctcacaacatttcaatatacagacacttattttatggttggtcgttagctattctgtccaagtttgttggatgagta |
29285388 |
T |
 |
Q |
101 |
cttgt |
105 |
Q |
|
|
||||| |
|
|
T |
29285389 |
cttgt |
29285393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 6 - 105
Target Start/End: Original strand, 35233199 - 35233298
Alignment:
Q |
6 |
ttggtgtttccgttttccctcacaacatttcaatatacagacacttattttatggttggtcgttagctattctgtccaagtttgttggatgagtacttgt |
105 |
Q |
|
|
|||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
T |
35233199 |
ttggtgcttccgttttccttcacaacatttcaatataaagacacttattttatggttggtcattagctattctgtccaagtttgttggatgagtaattgt |
35233298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University