View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_120 (Length: 202)
Name: NF0493_low_120
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_low_120 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 30877918 - 30878026
Alignment:
| Q |
1 |
aaacaatggaataaggagaggtgtttgttctgtgtcagagttgttttggagtgtgatagtgatgaaaatgacagtgtcagtgaacaagtgacagtagatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30877918 |
aaacaatggaataaggagaggtgtttgttctgtgtcagagttgttttggagtgtgatagtgatgaaaatgacagtgtcagtgaacaagtgacagtagatg |
30878017 |
T |
 |
| Q |
101 |
atgatgatg |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
30878018 |
atgatgatg |
30878026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University