View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_37 (Length: 391)
Name: NF0493_low_37
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 30 - 244
Target Start/End: Complemental strand, 7004045 - 7003830
Alignment:
| Q |
30 |
cactccaccatattctagaattggatatgccaaatatagnnnnnnnnnnnnnctatgaggacaaaaaa-tgcactgttaagcagagatccattttttcaa |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
7004045 |
cactccaccatattctagaattggatatgccaaatatagaagaagaaaaaaactatgaggacaaaaaaatgcactgttaagcagagatcccttttttcaa |
7003946 |
T |
 |
| Q |
129 |
gagacatgaggcacatctcttgtccattctccttaaaaaatgagtaatttattacttttataattgagatttgacatcaattttattttcaacgagtaca |
228 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7003945 |
gagacatgaggtacatctcttgtccatcctccttaaaaaatgagtaatttattacttttataattgagatttgacatcaattttattttcaacgagtaca |
7003846 |
T |
 |
| Q |
229 |
aaaacatgcttgtgtt |
244 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7003845 |
aaaacatgcttgtgtt |
7003830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 240 - 381
Target Start/End: Complemental strand, 7003675 - 7003543
Alignment:
| Q |
240 |
gtgtttgagtcttttatcacgcagatgaaccatataacaattcactacttttctttacaatctttacaaataatgtattttggatggttacttcatgata |
339 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7003675 |
gtgtttgaatcttttatcacgcagatagaccatataacaattcactgcttttctttacaa---------ataatgtattttggatggttacttcatgata |
7003585 |
T |
 |
| Q |
340 |
tgatgttagagctgattagatggcatattgtttaatcctttg |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7003584 |
tgatgttagagctgattagatggcatattgtttaatcctttg |
7003543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University