View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_41 (Length: 379)
Name: NF0493_low_41
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_low_41 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 7e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 242 - 379
Target Start/End: Original strand, 8171634 - 8171771
Alignment:
| Q |
242 |
tttccagtcttaactttcttaatttcattttgcaggccaaaagggacaaagaacccgatgtagtcgaattcatatcagctattgcagcaggaaaaaatgc |
341 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8171634 |
tttccagtcttatctttcttaatttcattttgcaggccaaaagggacaaagaacccgatgtagccgaattcatatcagctattgcagcaggaaaaaatgc |
8171733 |
T |
 |
| Q |
342 |
acaactcatggtggtagcaagtgctaacgtgactagtt |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8171734 |
acaactcatggtggtagcaagtgctaacgtggctagtt |
8171771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 21 - 107
Target Start/End: Original strand, 8171400 - 8171485
Alignment:
| Q |
21 |
acatcatcatgtctgaatggtcacctgaaaatgccaagaaggcttatcttcaagctctcaaaatggtaagcagagaaaagagcatat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8171400 |
acatcatcatgtctgaatggtcacctgaaaatgccaagaaggcttatcttcaagctctcaaaatggtaagcagag-aaagagcatat |
8171485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University