View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_49 (Length: 369)
Name: NF0493_low_49
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 304
Target Start/End: Complemental strand, 2786222 - 2785919
Alignment:
Q |
1 |
agtccttccggaacaacaaacttgccttcaaatcaaattcatgttaaagttgatgatgtatctgtcgcaccagttacgggggcacccccatcttcattgc |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2786222 |
agtccttccggaacaacaaacttgccttcaaatcaaattcatgttaaagttgacgatgtatctgtcgcaccagttacgggggcacccccatcttcattgc |
2786123 |
T |
 |
Q |
101 |
catcggtgaatggatctattgctaaccggcagccaatacctaatgtgaatgtgactcctgctactgtaaaagttgagccagtgcctgtaaaagttgagcc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
2786122 |
catcggtgaatggatctattgctaaccggcagccaatacctaatgtcagtgtgactcctgctactgtaaaagctgagccagtgcctgtaaaagttgagcc |
2786023 |
T |
 |
Q |
201 |
attgccggtaaaagttgagcgtggcgtaaaaattgagcgtggcacggcattttctggaccatcagtaattactagttcgggatatcttactgcttctaca |
300 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
2786022 |
attgccggtaaaagttgagcgtgtcgtaaaaattgagcgtggcacgacatcttctggaccgccagtaattactagttcgggatatcttactgcttctaca |
2785923 |
T |
 |
Q |
301 |
cagg |
304 |
Q |
|
|
|||| |
|
|
T |
2785922 |
cagg |
2785919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 23 - 104
Target Start/End: Original strand, 22518297 - 22518378
Alignment:
Q |
23 |
tgccttcaaatcaaattcatgttaaagttgatgatgtatctgtcgcaccagttacgggggcacccccatcttcattgccatc |
104 |
Q |
|
|
||||||||||||||| || ||| ||||| || | |||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
T |
22518297 |
tgccttcaaatcaaagtcctgtaaaagtagacgctgtatctgccacaccagttacgggggcacccccatcttcattgccatc |
22518378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 106 - 173
Target Start/End: Original strand, 22519728 - 22519795
Alignment:
Q |
106 |
gtgaatggatctattgctaaccggcagccaatacctaatgtgaatgtgactcctgctactgtaaaagt |
173 |
Q |
|
|
||||||||||||||| | |||||||| ||||||||| || ||||||||||||||||||||||||||| |
|
|
T |
22519728 |
gtgaatggatctattccgaaccggcaaccaatacctgctgggaatgtgactcctgctactgtaaaagt |
22519795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 253 - 304
Target Start/End: Original strand, 22520289 - 22520340
Alignment:
Q |
253 |
tctggaccatcagtaattactagttcgggatatcttactgcttctacacagg |
304 |
Q |
|
|
|||||||| |||||||| |||||||| |||| ||||||||||||| |||||| |
|
|
T |
22520289 |
tctggaccgtcagtaataactagttctggatctcttactgcttctgcacagg |
22520340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 591 times since January 2019
Visitors: 3484