View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_58 (Length: 340)
Name: NF0493_low_58
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_low_58 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 65 - 275
Target Start/End: Complemental strand, 2786129 - 2785919
Alignment:
| Q |
65 |
tcattgccatcggtgaatggatctattgctaaccggcagccaatacctaatgtgaatgtgactcctgctactgtaaaagttgagccagtgcctgtaaaag |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2786129 |
tcattgccatcggtgaatggatctattgctaaccggcagccaatacctaatgtcagtgtgactcctgctactgtaaaagctgagccagtgcctgtaaaag |
2786030 |
T |
|
| Q |
165 |
ttgagccattgccggtaaaagttgagcgtggcgtaaaaattgagcgtggcacggcattttctggaccatcagtaattactagttcgggatatcttactgc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2786029 |
ttgagccattgccggtaaaagttgagcgtgtcgtaaaaattgagcgtggcacgacatcttctggaccgccagtaattactagttcgggatatcttactgc |
2785930 |
T |
|
| Q |
265 |
ttctacacagg |
275 |
Q |
| |
|
||||||||||| |
|
|
| T |
2785929 |
ttctacacagg |
2785919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 2786222 - 2786164
Alignment:
| Q |
1 |
agtccttccggaacaacaaacttgccttcaaatcaaattcatgttaaagttgatgatgt |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2786222 |
agtccttccggaacaacaaacttgccttcaaatcaaattcatgttaaagttgacgatgt |
2786164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 77 - 144
Target Start/End: Original strand, 22519728 - 22519795
Alignment:
| Q |
77 |
gtgaatggatctattgctaaccggcagccaatacctaatgtgaatgtgactcctgctactgtaaaagt |
144 |
Q |
| |
|
||||||||||||||| | |||||||| ||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
22519728 |
gtgaatggatctattccgaaccggcaaccaatacctgctgggaatgtgactcctgctactgtaaaagt |
22519795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 224 - 275
Target Start/End: Original strand, 22520289 - 22520340
Alignment:
| Q |
224 |
tctggaccatcagtaattactagttcgggatatcttactgcttctacacagg |
275 |
Q |
| |
|
|||||||| |||||||| |||||||| |||| ||||||||||||| |||||| |
|
|
| T |
22520289 |
tctggaccgtcagtaataactagttctggatctcttactgcttctgcacagg |
22520340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 356 times since January 2019
Visitors: 3470