View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_63 (Length: 319)
Name: NF0493_low_63
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_low_63 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 118 - 290
Target Start/End: Complemental strand, 54775 - 54603
Alignment:
Q |
118 |
ccatagattacatttcaatattattagctagatagattacatgatggaacatgcatttacattgtcatcgttaaaaagggagacaagtaattcttcttga |
217 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54775 |
ccatagattacatttcaatattattagctagatagattacatgatggaacatgcatttacattgtcatcgttaaaaagggagacaagtaattcttcttga |
54676 |
T |
 |
Q |
218 |
tgattggatgaggccataggggcagcctgcacaacgtttctaacaaatccagagggtgcccttttgtcatagg |
290 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54675 |
tgattggatgaggccataggggcagcctgcacaacgtttctaacaaatccagagggtgcccttttgtcatagg |
54603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University