View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_65 (Length: 319)
Name: NF0493_low_65
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_low_65 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 60 - 222
Target Start/End: Complemental strand, 33827818 - 33827656
Alignment:
| Q |
60 |
atgacgtatttcaattcatacagtcaactccacttagtggaataatgattgggggttgttatcggtgccatatggtaataatgggctctaacgttatctc |
159 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33827818 |
atgacgtatttcgattcatacagtcaactccacttagtggaataatgattgggtgttgttatcggtgccatatggtaataatgggctctaacgttatctc |
33827719 |
T |
|
| Q |
160 |
gtgttggttttgcggttgttttgcggattccaattcccatttgcttttaagctgtgattttcc |
222 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33827718 |
gtgttggttttgcggttgttttgtcgattccaattcccatttgcttttaagctgtgattttcc |
33827656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 341 times since January 2019
Visitors: 3470