View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_67 (Length: 318)
Name: NF0493_low_67
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_low_67 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 102 - 247
Target Start/End: Complemental strand, 25520981 - 25520836
Alignment:
| Q |
102 |
agatagaaggtttattctatggtattcttatgaaatatacaaaaaagatgttttatattgcttaaacggtttttatacaaaaataatttgtaacaattgc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25520981 |
agatagaaggtttattctatggtattcttatgaaatatacaaaaaagatgttttatattgcttaaacggtttttatacaaaaataatttgtaacaattgc |
25520882 |
T |
 |
| Q |
202 |
ctcgggtgtttaagaagcaatttccttacatatattcatctcactc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
25520881 |
ctcgggtgtttaagaagcaatttccttacatatatccatcccactc |
25520836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University