View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_71 (Length: 312)
Name: NF0493_low_71
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_low_71 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 53 - 255
Target Start/End: Original strand, 30004666 - 30004868
Alignment:
| Q |
53 |
acaacaaaaactaaccatagaggattagagagaaaacattggtccacagttgttttgtaaggatattcgttacaactgttttcacgttatccgtacttgt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30004666 |
acaacaaaaactaaccatagaggattagagagaaaacattggtccacacttgttttgtaaggatattcgttacaactgttttcacgttatccgtacttgt |
30004765 |
T |
|
| Q |
153 |
gttatttgaaatgagagtaattcttggannnnnnngtcaaaatcgcaacttttagatcgtgttcaactttattcatgatggtggcttaaagctcataagt |
252 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| ||||||||||||||| ||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
30004766 |
gttatttgaaatgagattaattcttggattttttcgtcaaaattgcaacttttagatcgcattcaactttattcatgacggtggcttgaagctcataagt |
30004865 |
T |
|
| Q |
253 |
tgt |
255 |
Q |
| |
|
||| |
|
|
| T |
30004866 |
tgt |
30004868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 267 - 303
Target Start/End: Original strand, 8293737 - 8293773
Alignment:
| Q |
267 |
aataacaattgtagaatattagtatgttaatagttag |
303 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8293737 |
aataacaaatgtagaatattagtatgttaatagttag |
8293773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 199 - 247
Target Start/End: Complemental strand, 34403845 - 34403797
Alignment:
| Q |
199 |
aacttttagatcgtgttcaactttattcatgatggtggcttaaagctca |
247 |
Q |
| |
|
||||||||||||||||| ||||||||| || || |||||||||||||| |
|
|
| T |
34403845 |
aacttttagatcgtgttaaactttatttatagtgatggcttaaagctca |
34403797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 367 times since January 2019
Visitors: 3472