View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_72 (Length: 312)
Name: NF0493_low_72
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_low_72 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 7 - 285
Target Start/End: Complemental strand, 21026945 - 21026666
Alignment:
| Q |
7 |
gcagcacagacaacagccga-aaaatgcaaaagaggattcagatctacgccctgaaaacactcgttaacaatatccgtaatttatttgaacatgattagt |
105 |
Q |
| |
|
|||| ||||||| ||||||| |||||||||||||||||| ||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21026945 |
gcaggacagacagcagccgagaaaatgcaaaagaggattaagatctatgtcctgaaaacactcgttaacaatatccgtaatttatttgaacatgaatagt |
21026846 |
T |
|
| Q |
106 |
aaacccaaaactaaatccaatgccctgtctgtacagtactattcctgcaagatccgaagacacgttttaagtgtacatttaatgtagagaggaaatgcca |
205 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21026845 |
aaacccaaaactaaatccaatggactgtctgtacagtactattcctgcaagatccgaagacacgttttaagtgtacatttaatgtagagaggaaatgcca |
21026746 |
T |
|
| Q |
206 |
tgattgaactgtaaaggcaaaattagtggcagcattaatcagctgaaaatcatatgagcctcaggtaaactttagaaatg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21026745 |
tgattgaactgtaaaggcaaaattagtggcagcattaatcagctgaaaatcatatgagcctcaggtaaactttagaaatg |
21026666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 155 times since January 2019
Visitors: 3464