View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_76 (Length: 296)
Name: NF0493_low_76
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_low_76 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 103 - 222
Target Start/End: Original strand, 12504115 - 12504225
Alignment:
Q |
103 |
agctattagtgaatttgttcgcttttaaatttaaagcactgaaaaattggttggacaatttgcttggtgtaaattgtctttagttcgaccccacagctaa |
202 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
12504115 |
agctattagtgaatttgttcgctttcaaatttaaagcactgaaaaattggttggacaatttgcttggtgtaaat---------ttcgaccccacagctaa |
12504205 |
T |
 |
Q |
203 |
tctataagtgaaattataaa |
222 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
12504206 |
tctataagtgaaattataaa |
12504225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University