View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_88 (Length: 276)
Name: NF0493_low_88
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0493_low_88 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 30 - 270
Target Start/End: Original strand, 9408219 - 9408459
Alignment:
Q |
30 |
acaagtcactttaatgcaactcattattatagtatgataattgtagttttgtactttctacgtattatagtattctagttctatacttactacgtatccg |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9408219 |
acaagtcactttaatgcaactcattattatagtatgataattgtagttttgtactttctacgtattatagtattctagttctatacttactacgtatccg |
9408318 |
T |
 |
Q |
130 |
aaatttaattttcattagtgcatcagcattacgtagtgaatgatgtaagtaacttttaatcaagttcattcacatggtcttatgagaagcttcgtgaaag |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
9408319 |
aaatttaattttcattagtgcatcagcattacgtagtgaatgatgtaagtaacttttaatcaagttcattcacattgtcttatgagaagcttcgtgaaag |
9408418 |
T |
 |
Q |
230 |
cttccgtctttttattatgctgtgattcttgttcttttctc |
270 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
9408419 |
cttccatctttttattatgctgtgattcttgttcttttctc |
9408459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University