View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_98 (Length: 251)
Name: NF0493_low_98
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_low_98 |
 |  |
|
| [»] chr2 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 29 - 251
Target Start/End: Original strand, 41216964 - 41217186
Alignment:
| Q |
29 |
acttcaaaccttcaccagtttgccccccttacaaggtacttgaaggtgcaacccaaaaataaaacattattcctagaaccagtgtgacacaatgtatgat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41216964 |
acttcaaaccttcaccagtttgccccccttacaaggtacttgaaggtgcaacccaaaaataaaacattattcctagaaccagtgtgacacaatgtatgat |
41217063 |
T |
 |
| Q |
129 |
tgtaaccattgaaatagaatgataacatcacttagtcaccaatatgtcatgtcttcttcattgtgaatcctgcaaggttggatgaaatcaagtaacaatt |
228 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41217064 |
tgttaccattgaaatagaatgataacatcacttagtcaccaatatgtcatgtcttcttcattgtgaatcctgcaaggttggatgaaatcaagtaacaatt |
41217163 |
T |
 |
| Q |
229 |
gatatcagtgcttctaacagtac |
251 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
41217164 |
gatatcagtgcgtctaacagtac |
41217186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 161 - 243
Target Start/End: Original strand, 41222888 - 41222970
Alignment:
| Q |
161 |
tagtcaccaatatgtcatgtcttcttcattgtgaatcctgcaaggttggatgaaatcaagtaacaattgatatcagtgcttct |
243 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||| ||||||||||||||| |||||| ||| ||| |||||||| |
|
|
| T |
41222888 |
tagtcaccaatatgtcatgtcttctccatgttgaatcctgcaaagttggatgaaatcaaataacaagtgacatcggtgcttct |
41222970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 161 - 243
Target Start/End: Complemental strand, 16234132 - 16234050
Alignment:
| Q |
161 |
tagtcaccaatatgtcatgtcttcttcattgtgaatcctgcaaggttggatgaaatcaagtaacaattgatatcagtgcttct |
243 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||| ||||||||||||| | |||||| ||| ||| |||||||| |
|
|
| T |
16234132 |
tagtcaccaatatgtcatgtcttctccatgttgaatcctgcaaagttggatgaaatccaataacaagtgacatcggtgcttct |
16234050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 74 - 120
Target Start/End: Complemental strand, 16234263 - 16234217
Alignment:
| Q |
74 |
gtgcaacccaaaaataaaacattattcctagaaccagtgtgacacaa |
120 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
16234263 |
gtgcaacccaataataaagtattgttcctagaaccagtgtgacacaa |
16234217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 161 - 243
Target Start/End: Complemental strand, 1598780 - 1598698
Alignment:
| Q |
161 |
tagtcaccaatatgtcatgtcttcttcattgtgaatcctgcaaggttggatgaaatcaagtaacaattgatatcagtgcttct |
243 |
Q |
| |
|
|||||| |||||||||||||||||| ||| | |||||||||| | |||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
1598780 |
tagtcaacaatatgtcatgtcttctccatgttaaatcctgcaaagatggatgaaatcaagtaacaagtgatatcagtgtttct |
1598698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University