View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0493_low_99 (Length: 251)
Name: NF0493_low_99
Description: NF0493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0493_low_99 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 125 - 244
Target Start/End: Original strand, 5434056 - 5434175
Alignment:
| Q |
125 |
aattaactaactaaagtaattgaataaaatccttcgatttcgattgcaattttgctatcccgtatcaatcgtacaaaagccagttgagtaaaatcctcga |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5434056 |
aattaactaactaaagtaattgaataaaatccttcgatttcgattgcaattttgctatcccgtatcaatcgtacaaaagccagttgagtaaaatcctcga |
5434155 |
T |
|
| Q |
225 |
ttttgattttgctgtcccct |
244 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
5434156 |
ttttgattttgctgtcccct |
5434175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 598 times since January 2019
Visitors: 3484