View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0494_high_1 (Length: 340)
Name: NF0494_high_1
Description: NF0494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0494_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 79 - 247
Target Start/End: Complemental strand, 47921465 - 47921297
Alignment:
| Q |
79 |
gatgaacacgtaaacagatgctggcacttactctttggtgcctaaacaagttttaggataagatctggtttaccgaattaatattatactgtctcattct |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47921465 |
gatgaacacgtaaacagatgctggcacttactctttggtgcctaaacaagttttaggataagatctggtttaccgaattaatattatactgtctcattct |
47921366 |
T |
 |
| Q |
179 |
catagctcataagtgataagtatatattctttcaattctttcttttcataagtgataagtatatattct |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47921365 |
catagctcataagtgataagtatatattctttcaattctttcttttcataagtgataagtatatattct |
47921297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University