View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0494_high_3 (Length: 276)
Name: NF0494_high_3
Description: NF0494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0494_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 30 - 266
Target Start/End: Original strand, 3010186 - 3010421
Alignment:
| Q |
30 |
gaatgtgcccagacatattttatttgggtttatgaccaaattagtatttcggttaccaactctnnnnnnnnnnggttacaatccaattttcccaacatgt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3010186 |
gaatgtgcccagacatattttatttgggtttatgaccaaataagtatttcggttaccaactctaaaaaaaaa-ggttacaatccaattttcccaacatgt |
3010284 |
T |
 |
| Q |
130 |
tcactaaagagcaatgtgaacattagtgcacatatagtgtcattgccattattgttactccaaatggaaaacccaatttgatggaattcagatttgctct |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3010285 |
tcactaaagagcaatgtgaacattagtgcacatatagtgtcattgccattattgttactctaaatggaaaacccaatttgatggaattcagatctgctct |
3010384 |
T |
 |
| Q |
230 |
agtacctatatgttccagtttccaagtttgcttcatc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3010385 |
agtacctatatgttccagtttccaagttcacttcatc |
3010421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 122 - 203
Target Start/End: Original strand, 3019051 - 3019131
Alignment:
| Q |
122 |
caacatgttcactaaagagcaatgtgaacattagtgcacatatagtgtcattgccattattgttactccaaatggaaaaccc |
203 |
Q |
| |
|
|||||||||| ||||||||||||||||| || ||||| ||| | ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3019051 |
caacatgttctttaaagagcaatgtgaacgttggtgcatataaa-tgtcattgccattattgttactccaaatgaaaaaccc |
3019131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University