View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0495_high_5 (Length: 293)
Name: NF0495_high_5
Description: NF0495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0495_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 141 - 287
Target Start/End: Original strand, 46748686 - 46748832
Alignment:
| Q |
141 |
aaacataacaaacctcctttcttctccatccgcaattgcaccacttccaattccatctcagcgaaaccatcttcccaactccgtaaaaatcgttcctcaa |
240 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46748686 |
aaacataacaaaccccctttcttctccatccgcaattgcaccacttccaattccatctcagcgaaaccatcttcccaactccgtaaaaaccgttcctcaa |
46748785 |
T |
 |
| Q |
241 |
attccgactccgaccccaaactcaccgccctccgccgtctctgctcc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46748786 |
attccgactccgaccccaaactcaccgccctccgccgtctcttctcc |
46748832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 22 - 53
Target Start/End: Original strand, 46748579 - 46748610
Alignment:
| Q |
22 |
catcatcatcatcacctgcaactgtaacgaaa |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46748579 |
catcatcatcatcacctgcaactgtaacgaaa |
46748610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University