View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0495_low_15 (Length: 293)
Name: NF0495_low_15
Description: NF0495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0495_low_15 |
 |  |
|
[»] scaffold0103 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 62 - 241
Target Start/End: Complemental strand, 22412129 - 22411938
Alignment:
Q |
62 |
gacatcatcataatgtttgagatataaactaactaggttgcttaacaatattcttactaagcaattaatcaagaacaaaacatcaacc------------ |
149 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22412129 |
gacatcatcataatatttgagatataaactaactagggtgcttaacaatattcttactaagcaattaatcaagaacaaaacatcaacctaacaaacatca |
22412030 |
T |
 |
Q |
150 |
tcaaaacttaaactaataaactaaaggagcaactgcattcatctccccaacatgaagatggaagttgtaggtcttcttacaccacctctctg |
241 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
T |
22412029 |
tcaaaacttaaactaataaactaaaggagcaactacattcatctccccaacatgaagatggaagttgttggtcttcttacgccacctctctg |
22411938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0103 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0103
Description:
Target: scaffold0103; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 188 - 238
Target Start/End: Complemental strand, 14438 - 14388
Alignment:
Q |
188 |
tcatctccccaacatgaagatggaagttgtaggtcttcttacaccacctct |
238 |
Q |
|
|
|||||||||||||||| ||||||||||||| ||||| |||| |||||||| |
|
|
T |
14438 |
tcatctccccaacatgtagatggaagttgttggtctccttatgccacctct |
14388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University