View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0495_low_7 (Length: 333)
Name: NF0495_low_7
Description: NF0495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0495_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 173 - 252
Target Start/End: Original strand, 49542656 - 49542733
Alignment:
Q |
173 |
gccagccagaagtgctcacccggtgatggcgtcacactgccttctcttgtcactgttttttactctcaattctctctgct |
252 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
49542656 |
gccagccagaagtgctcacgcggtgatggcgtcacactgccttctcttgtcactgtttttta--ctcaattctctctgct |
49542733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 115 - 175
Target Start/End: Original strand, 49542555 - 49542615
Alignment:
Q |
115 |
tatgactggctatttcatgtacaatagttaaaattataaatcaccgatttctcctcatgcc |
175 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
49542555 |
tatgactggctatttcatgtacaatagttaaaattataaatcaccaatttctcctcatgcc |
49542615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University