View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0495_low_8 (Length: 314)
Name: NF0495_low_8
Description: NF0495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0495_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 76 - 227
Target Start/End: Complemental strand, 8405828 - 8405677
Alignment:
Q |
76 |
actgatatgaacatataatatcattcatctacaagtattgcatgaatgacaaggtacacgattcaaaatctaagacttttgcgatccttcaaaacctgat |
175 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8405828 |
actgttatgaacatataatatcattcatctacaagtattgcatgaatgacaaggtacacgattcaaaatctaagacttttgcgatccttcaaaacctgat |
8405729 |
T |
 |
Q |
176 |
caactttgtctaggtggaatttcatagacaatttgatctatcagtgatgatg |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8405728 |
caactttgtctaggtggaatttcatagacaatttgatctatcagtgatgatg |
8405677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University