View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497-Insertion-13 (Length: 196)
Name: NF0497-Insertion-13
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0497-Insertion-13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 2e-72; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 55 - 192
Target Start/End: Original strand, 46872179 - 46872316
Alignment:
Q |
55 |
tatttacctagatttatcatttgtcttgctttattgggaagctgctgcctgctggagttttgttttgacatagtggtgggtggtccccaactaaaaaacc |
154 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46872179 |
tatttacctagatttatcatttgtcttgctttattgggaagctgctgcctgctggagttttgttttgacatagtggtgggtggtccccaactaaaaaacc |
46872278 |
T |
 |
Q |
155 |
ttaaaccttgtcacttcctcactatatatatgccatca |
192 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
46872279 |
ttaaaccttgtcacttcctcactatatatatgccatca |
46872316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 145 - 187
Target Start/End: Original strand, 46889596 - 46889638
Alignment:
Q |
145 |
ctaaaaaaccttaaaccttgtcacttcctcactatatatatgc |
187 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
46889596 |
ctaaaaaaccttaaaccttgccacttcctcactatatatatgc |
46889638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 178
Target Start/End: Original strand, 46863182 - 46863220
Alignment:
Q |
140 |
cccaactaaaaaaccttaaaccttgtcacttcctcacta |
178 |
Q |
|
|
||||||||||||||||||||||| |||||| |||||||| |
|
|
T |
46863182 |
cccaactaaaaaaccttaaacctcgtcactgcctcacta |
46863220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University