View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497-Insertion-16 (Length: 123)
Name: NF0497-Insertion-16
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0497-Insertion-16 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 6 - 123
Target Start/End: Complemental strand, 16947958 - 16947841
Alignment:
| Q |
6 |
cagtttcttcgcaacttcgtattggaagagttagtaagccagtgaggttgcaacctatgatgaagaatgttaatgaagggaaaggtatttttgctccact |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16947958 |
cagtttcttcgcaacttcgtattggaagagttagtaaaccagtgaggttgcaacctatgatgaagaatgttaatgaagggaaaggtatttttgctccact |
16947859 |
T |
 |
| Q |
106 |
tgttgtggttacacgtga |
123 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
16947858 |
tgttgtggttactcgtga |
16947841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University