View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497-Insertion-17 (Length: 74)
Name: NF0497-Insertion-17
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0497-Insertion-17 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 2e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 8 - 74
Target Start/End: Complemental strand, 49889277 - 49889211
Alignment:
| Q |
8 |
gcgagttcaccagagttcacacattcttgcatcgaaagcgcggtttctgtcataacatgttcactta |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49889277 |
gcgagttcaccagagttcacacattcttgcatcgaaagcgcggtttctgtcataacatgttcactta |
49889211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University