View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497-Insertion-5 (Length: 327)
Name: NF0497-Insertion-5
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0497-Insertion-5 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 8 - 327
Target Start/End: Complemental strand, 5396375 - 5396056
Alignment:
| Q |
8 |
cgttccaaattgcaattacattacaatttttgcattggttgtttccaccaccatgacatcaacctacggcacaatcccaacctcaccaacaccaccaaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396375 |
cgttccaaattgcaattacattacaatttttgcattggttgtttccaccaccatgacatcaacctacggcacaatcccaacctcaccaacaccaccaaaa |
5396276 |
T |
 |
| Q |
108 |
cttgaatacataacacgtggcaaacaacggatcaaggccggcttaggaactcgtcgaccgtggaaaaccatgtttgatatccggtcactcggcatcccca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5396275 |
cttgaatacataacacgtggcaaacaacggatcaaggccggcttaggaactcgtcgaccgtggaaaaccatgttcgatatccggtcactcggcatcccca |
5396176 |
T |
 |
| Q |
208 |
ctggtgtaccggaagcaatttcacgtgttcgtgtcaacatctcatacttccgcatgaactacactatggtgatgcttttgattttgtttctgagcctttt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396175 |
ctggtgtaccggaagcaatttcacgtgttcgtgtcaacatctcatacttccgcatgaactacactatggtgatgcttttgattttgtttctgagcctttt |
5396076 |
T |
 |
| Q |
308 |
atggcatccttactcactca |
327 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
5396075 |
atggcatccttactcactca |
5396056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University