View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497-Insertion-7 (Length: 257)
Name: NF0497-Insertion-7
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0497-Insertion-7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 8 - 257
Target Start/End: Complemental strand, 34501637 - 34501388
Alignment:
| Q |
8 |
tggaggcctaatggtgggaggatgcttgctgttggtagcaagtgagtttctgtctttgtgctcggttgtacagtgtcaattgttgggtcattggattttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34501637 |
tggaggcctaatggtgggaggatgcttgctgttggtagcaagtgagtttctgtctttgtgctcggttgtacaatgtcaattgttgggtcattggattttt |
34501538 |
T |
 |
| Q |
108 |
tgttaactggacttgggtttactgatgcaggagtggaatttgcttgtggtctgcttcatatcctggaaatgccgcatctgctagatctggcactatttcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34501537 |
tgttaactggacttgggtttactgatgcaggagtggaatttgcttgtggtctgcttcatatcctggaaatgccgcatctgctagatctggcactatttcc |
34501438 |
T |
 |
| Q |
208 |
tttgtaggaagtttatctagaggctctggaattcggtatctcctagtcga |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34501437 |
tttgtaggaagtttatctagaggctctggaattcggtatctcctagtcga |
34501388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University