View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497-Insertion-9 (Length: 254)
Name: NF0497-Insertion-9
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0497-Insertion-9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 8 - 254
Target Start/End: Complemental strand, 48286713 - 48286467
Alignment:
| Q |
8 |
atatgggggtagggtaaaggctatagtagatacaagtgtaaagattctttataaacaaatccttgatacgatgtaaaatgattgtttgttggtaatataa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286713 |
atatgggggtagggtaaaggctatagtagatacaagtgtaaagattctttataaacaaatccttgatacgatgtaaaatgattgtttgttggtaatataa |
48286614 |
T |
|
| Q |
108 |
aagatttgcacaaggaaaatagtaaaattatgtgcacaaccttatgatttatgtaacgttcgcgtatgtatgaactgttgcagttcttgttatttctctt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48286613 |
aagatttgcacaaggaaaatagtaaaattatgtgcacaaccttatgatttatgtgacgttcgcgtatgtatgaactggtgcagttcttgttatttctctt |
48286514 |
T |
|
| Q |
208 |
ctgcctcaaagacattggaagatgctgaagaagaaatgttgaaacta |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286513 |
ctgcctcaaagacattggaagatgctgaagaagaaatgttgaaacta |
48286467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1262 times since January 2019
Visitors: 3440