View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497_high_10 (Length: 331)
Name: NF0497_high_10
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0497_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 238 - 308
Target Start/End: Original strand, 392510 - 392576
Alignment:
Q |
238 |
taccctacaacatcatttctgtaaggctgatggaaagtgaacacaacttaattaaccataaagaaataaca |
308 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
T |
392510 |
taccctacaacatcatttctgtaaggctgatggaaagtgaatacaac----ttaaccataaagaaataaca |
392576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 121 - 199
Target Start/End: Complemental strand, 5948088 - 5948005
Alignment:
Q |
121 |
atttaaccatgccaacagctagggttacacatctaagtatgtc-----attctacttttgcttttgagcctgaaaaataacaaa |
199 |
Q |
|
|
||||||||||||||||||| |||||||| |||||||||||||| ||| || ||||| ||||| ||||||||||||||||| |
|
|
T |
5948088 |
atttaaccatgccaacagccagggttacgcatctaagtatgtcagattattgtatttttgtttttgggcctgaaaaataacaaa |
5948005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 59
Target Start/End: Original strand, 392395 - 392432
Alignment:
Q |
22 |
caaaataaaggaaattcttaggcactcagttgtgcttt |
59 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
392395 |
caaaataaaggaaattcttaggcactcagttgtgcttt |
392432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University