View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0497_high_12 (Length: 282)

Name: NF0497_high_12
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0497_high_12
NF0497_high_12
[»] chr7 (2 HSPs)
chr7 (172-262)||(16263284-16263373)
chr7 (175-241)||(39740990-39741055)
[»] chr4 (1 HSPs)
chr4 (175-241)||(6897454-6897519)


Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 172 - 262
Target Start/End: Complemental strand, 16263373 - 16263284
Alignment:
172 tgatgtctgcagatataagatgattttttagccggtatcttatgatgaaacaaaactacaatgtttgaaagttgcatattttatctgtgct 262  Q
    ||||||||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
16263373 tgatgtctgcagaaataagatgattttt-agccagtatcttatgatgaaacaaaactacaatgtttgaaacttgcatattttatctgtgct 16263284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 175 - 241
Target Start/End: Complemental strand, 39741055 - 39740990
Alignment:
175 tgtctgcagatataagatgattttttagccggtatcttatgatgaaacaaaactacaatgtttgaaa 241  Q
    ||||||||||||||||||||||||| ||||  |||||||||||||||||||||||||||||||||||    
39741055 tgtctgcagatataagatgattttt-agccattatcttatgatgaaacaaaactacaatgtttgaaa 39740990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 175 - 241
Target Start/End: Complemental strand, 6897519 - 6897454
Alignment:
175 tgtctgcagatataagatgattttttagccggtatcttatgatgaaacaaaactacaatgtttgaaa 241  Q
    ||||||||||||||||||||||||| ||||  |||||||||||||||||||||||||||||||||||    
6897519 tgtctgcagatataagatgattttt-agccattatcttatgatgaaacaaaactacaatgtttgaaa 6897454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University