View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497_high_12 (Length: 282)
Name: NF0497_high_12
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0497_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 172 - 262
Target Start/End: Complemental strand, 16263373 - 16263284
Alignment:
| Q |
172 |
tgatgtctgcagatataagatgattttttagccggtatcttatgatgaaacaaaactacaatgtttgaaagttgcatattttatctgtgct |
262 |
Q |
| |
|
||||||||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16263373 |
tgatgtctgcagaaataagatgattttt-agccagtatcttatgatgaaacaaaactacaatgtttgaaacttgcatattttatctgtgct |
16263284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 175 - 241
Target Start/End: Complemental strand, 39741055 - 39740990
Alignment:
| Q |
175 |
tgtctgcagatataagatgattttttagccggtatcttatgatgaaacaaaactacaatgtttgaaa |
241 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39741055 |
tgtctgcagatataagatgattttt-agccattatcttatgatgaaacaaaactacaatgtttgaaa |
39740990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 175 - 241
Target Start/End: Complemental strand, 6897519 - 6897454
Alignment:
| Q |
175 |
tgtctgcagatataagatgattttttagccggtatcttatgatgaaacaaaactacaatgtttgaaa |
241 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6897519 |
tgtctgcagatataagatgattttt-agccattatcttatgatgaaacaaaactacaatgtttgaaa |
6897454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University