View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497_high_15 (Length: 252)
Name: NF0497_high_15
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0497_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 9e-45; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 30 - 195
Target Start/End: Complemental strand, 38744449 - 38744279
Alignment:
| Q |
30 |
tatacctcagatcaaactctatattaccgtgtctttctcgtaaaagcaagggttaacacaaaataaaacgacggtctgttaacaat-nnnnnnnggctat |
128 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38744449 |
tatacctcagatcaaactctaaattaccgtatctttctcgtaaaagcaagggttaacacaaaataaaacgacggtctgttaacaataaaaaaaaggctat |
38744350 |
T |
 |
| Q |
129 |
acgt----nnnnnnntaatcagcttttattcaaaactgaattattaatgatataaggtaaatggcttcttc |
195 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38744349 |
acgtaaaaaaaaaaaaaatcagcttttattcaaaactgaattattaatgatataaggtaaatggcttcttc |
38744279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 142 - 187
Target Start/End: Original strand, 38782022 - 38782067
Alignment:
| Q |
142 |
atcagcttttattcaaaactgaattattaatgatataaggtaaatg |
187 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
38782022 |
atcagcttttattcaaaactgatttattaatgatataaagtaaatg |
38782067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 145 - 187
Target Start/End: Original strand, 38788098 - 38788140
Alignment:
| Q |
145 |
agcttttattcaaaactgaattattaatgatataaggtaaatg |
187 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
38788098 |
agcttttattcaaaacggaattattaatgatataaagtaaatg |
38788140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University