View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497_high_17 (Length: 251)
Name: NF0497_high_17
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0497_high_17 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 29 - 251
Target Start/End: Complemental strand, 32199213 - 32198991
Alignment:
| Q |
29 |
atgttccacgggtatttggacataatggagttggagatttggtagttttgcgcatgttcaagttcaaatgatttcttactaaagaagaaaggtggacatt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32199213 |
atgttccacgggtatttggacataatggagttggagatttggtagttttgcgcatgttcaagttcaaatgatttcttactaaagaagaaaggtggacatt |
32199114 |
T |
|
| Q |
129 |
gttcacatataatcatattatgaacgaatatcggtggtttgactaagcttatatgagcataccaacttgatataatgaaaatgtcggggtaattattcac |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32199113 |
gttcacatataatcatattatgaacgaatatcggtagtttgactaaacttatatgagcataccaacttgatataatgaaaatgtcggggtaattattcac |
32199014 |
T |
|
| Q |
229 |
ggtgattaaaaacaaattagaaa |
251 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32199013 |
ggtgattaaaaacaaattagaaa |
32198991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 261 times since January 2019
Visitors: 3467