View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497_high_18 (Length: 251)
Name: NF0497_high_18
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0497_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 29 - 249
Target Start/End: Original strand, 8106183 - 8106408
Alignment:
| Q |
29 |
aaaaagaacaaaattgaaactaaacaaagttgaatgtatttaatatgaacctttcaaaaataatttaaaaatcgaaactaaaaatgaacatttacttacc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8106183 |
aaaaagaacaaaattgaaactaaacaaagttgaatgtatttaatatgaacctttcaaaaataatttaaaaatcgaaactaaaaatgaacatttacttacc |
8106282 |
T |
 |
| Q |
129 |
tactcaccc-----nnnnnnnnnggaggtttatgacttttggcttttttatgtgaaataatattgtacatctattaaaataacattttctctcataatca |
223 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| || |
|
|
| T |
8106283 |
tactcacccttttttttttttttggaggtttatgacttttggcttttttatgtgaaataatattgtacaactattgaaataacattttctctcataacca |
8106382 |
T |
 |
| Q |
224 |
tattgtgttcatactttctctttatt |
249 |
Q |
| |
|
||||||||||||||||||| |||||| |
|
|
| T |
8106383 |
tattgtgttcatactttctttttatt |
8106408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University