View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497_high_19 (Length: 250)
Name: NF0497_high_19
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0497_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 22 - 247
Target Start/End: Original strand, 383517 - 383742
Alignment:
| Q |
22 |
catcatcataaacatcattattggtagtagtatgactaagtagtgtcataaaa-tgtcatctaaacaactttacacaagtgaccaaattataagccaaga |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
383517 |
catcatcataaacatcattattggtagtagtatgactaagtagtgtcataaaaatgtcatctaaacaactttacacaagcgaccaaattataagccaaga |
383616 |
T |
|
| Q |
121 |
taactaataggttggaaaaaccaatataaccttgaaaagctaaaactcagagcttcttcttaagcttatacgatatcaacattcaacagtcagcaaacag |
220 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
383617 |
taactactaggttggaaaaaccaatataacctt-aaaagctaaaactcagagcttcttcttaagcttaaacgatatcaacattcaacagtcagcaaacag |
383715 |
T |
|
| Q |
221 |
atagattcattaaattcccttttattc |
247 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
383716 |
atagattcattaaattcccttttattc |
383742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 305 times since January 2019
Visitors: 3469