View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497_high_23 (Length: 222)
Name: NF0497_high_23
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0497_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 43665615 - 43665807
Alignment:
| Q |
1 |
ttggtgaatggaaacacgtgaaagagtttgctgtaagcaccggcggcgtaaccgaggatgttaccgacggccataaaaaacgagaaaaacgcgtttgcgt |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43665615 |
ttggtgaacggaaacacgtgaaagagtttgctgtaagcaccggcggcgtaaccgaggatgttaccgacggccataaaaaacgagaaaaacgcgtttgcgt |
43665714 |
T |
 |
| Q |
101 |
ttcttgttttttggtggttaccggcgcagaggtcaccaagaagtgcacggcaaggaccttgaagcatgttgttagcgacgtcgaggatccaga |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43665715 |
ttcttgttttttggtggttaccggcgcagaggtcaccaagaagtgcacggcaaggaccttgaagcatgttgttagcgacgtcgaggatccaga |
43665807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University