View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497_low_10 (Length: 331)
Name: NF0497_low_10
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0497_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 30 - 318
Target Start/End: Complemental strand, 40607083 - 40606795
Alignment:
| Q |
30 |
caattgtactctctaccatctttttgacgaatttaaatttgtcacctaataaaatgtgttggactatcgtcgttattcattctaataaacttgtttttac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40607083 |
caattgtactctctaccatctttttgacgaatttaaatttgtcacctaataaaatgtgttggactatcgtcgttattcattctaataaacttgtttttac |
40606984 |
T |
|
| Q |
130 |
ttctttnnnnnnntagtaccagaacttcttaccacatggctaatgatgagccctgctgtgggcctttgcaatagactctcggcattaatttagagggctc |
229 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40606983 |
ttctttaaaaaaatagtaccagaacttcataccacatggctaatgatgagccctgctgtgggcctttgcaatagactctcggcattaatttagagggctc |
40606884 |
T |
|
| Q |
230 |
caggtttagaaaccttgctgatttaagacacaacaattatgagacacaataaaatgtaatttgctcaaacgcttcccagcacgtgattc |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40606883 |
caggtttagaaaccttgctgatttaagacacaacaattatgagacacaataaaatgtaatttgctcaaacgcttcccagcacgtgattc |
40606795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1740 times since January 2019
Visitors: 3462