View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0497_low_11 (Length: 331)

Name: NF0497_low_11
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0497_low_11
NF0497_low_11
[»] chr6 (3 HSPs)
chr6 (238-308)||(392510-392576)
chr6 (121-199)||(5948005-5948088)
chr6 (22-59)||(392395-392432)


Alignment Details
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 238 - 308
Target Start/End: Original strand, 392510 - 392576
Alignment:
238 taccctacaacatcatttctgtaaggctgatggaaagtgaacacaacttaattaaccataaagaaataaca 308  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||    ||||||||||||||||||||    
392510 taccctacaacatcatttctgtaaggctgatggaaagtgaatacaac----ttaaccataaagaaataaca 392576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 121 - 199
Target Start/End: Complemental strand, 5948088 - 5948005
Alignment:
121 atttaaccatgccaacagctagggttacacatctaagtatgtc-----attctacttttgcttttgagcctgaaaaataacaaa 199  Q
    ||||||||||||||||||| |||||||| ||||||||||||||     ||| || ||||| ||||| |||||||||||||||||    
5948088 atttaaccatgccaacagccagggttacgcatctaagtatgtcagattattgtatttttgtttttgggcctgaaaaataacaaa 5948005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 59
Target Start/End: Original strand, 392395 - 392432
Alignment:
22 caaaataaaggaaattcttaggcactcagttgtgcttt 59  Q
    ||||||||||||||||||||||||||||||||||||||    
392395 caaaataaaggaaattcttaggcactcagttgtgcttt 392432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University