View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497_low_24 (Length: 237)
Name: NF0497_low_24
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0497_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 133 - 219
Target Start/End: Complemental strand, 3080318 - 3080232
Alignment:
Q |
133 |
gaagaatatgttagtatttgacacaaaaatgtatggagcaaacaacatagaataagtaacacgggaaacttgtgcttgaagtattta |
219 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||| ||||||| ||||| ||||| |
|
|
T |
3080318 |
gaagaaaatgttagtatttgacacaaaaatgtatggagcagacagcatagaataagtaacatgggagacttgtggatgaagaattta |
3080232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1421 times since January 2019
Visitors: 3449