View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497_low_29 (Length: 210)
Name: NF0497_low_29
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0497_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 97 - 184
Target Start/End: Original strand, 34723760 - 34723847
Alignment:
| Q |
97 |
cgctagtaatgtaagaggcggnnnnnnngtgcttggcgcttcttcacttgaataatcattcctgctcatcttactccaccttctctgc |
184 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34723760 |
cgctagtaatgtaagaggcagtttttttgtgcttggcgcttcttcacttgaataatcattcctgctcatcttactccaccttcactgc |
34723847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University