View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0497_low_29 (Length: 210)

Name: NF0497_low_29
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0497_low_29
NF0497_low_29
[»] chr3 (1 HSPs)
chr3 (97-184)||(34723760-34723847)


Alignment Details
Target: chr3 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 97 - 184
Target Start/End: Original strand, 34723760 - 34723847
Alignment:
97 cgctagtaatgtaagaggcggnnnnnnngtgcttggcgcttcttcacttgaataatcattcctgctcatcttactccaccttctctgc 184  Q
    ||||||||||||||||||| |       ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
34723760 cgctagtaatgtaagaggcagtttttttgtgcttggcgcttcttcacttgaataatcattcctgctcatcttactccaccttcactgc 34723847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University