View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497_low_6 (Length: 436)
Name: NF0497_low_6
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0497_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 174 - 340
Target Start/End: Original strand, 374580 - 374748
Alignment:
| Q |
174 |
cccaatagaatgaataacattaccccctcaaaaaatttcaaacccagatgggtttttgac--nnnnnnnnnnnngtttttctattcaatcatagtaaaat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
374580 |
cccaatagaatgaataacattaccccctcaaaaaatttcaaacccagatgggtttttgacaaaaaaaaaattagttttttctattcaatcatagtaaaat |
374679 |
T |
 |
| Q |
272 |
taaaatccattagaatgaagaacattaccgctnnnnnnnntccaaaaacccagataggattttgagaaa |
340 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
374680 |
taaaatacattagaatgaagaacattaccgctaaaaaaaatccaaaaacccagataggattttgagaaa |
374748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 41 - 114
Target Start/End: Original strand, 374447 - 374520
Alignment:
| Q |
41 |
aattaagtctaaaagaatggctcaaaaatctcaacaaatgactgaaaacccaagttttgataaactttgagaac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374447 |
aattaagtctaaaagaatggctcaaaaatctcaacaaatgactgaaaacccaagttttgataaactttgagaac |
374520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University