View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0497_low_9 (Length: 338)

Name: NF0497_low_9
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0497_low_9
NF0497_low_9
[»] chr7 (2 HSPs)
chr7 (87-240)||(38946738-38946891)
chr7 (91-167)||(42093600-42093676)
[»] chr8 (1 HSPs)
chr8 (196-240)||(45204141-45204185)


Alignment Details
Target: chr7 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 87 - 240
Target Start/End: Original strand, 38946738 - 38946891
Alignment:
87 cacagacacattttgtatcaattttttgaactatgattgttgacttgttgttgggaaggaaaatgataatggatggtctttgttcatnnnnnnnnnnnnn 186  Q
    |||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||                 
38946738 cacagatacattttgtatcaatcttttgaactatgattgttgacttgttgttgggaaggaaaatgataatggatggtctctgttcataaaaaataaaata 38946837  T
187 nnnnnngataacaaaatccctacaacatccagggccatcatcaaccgccttcgt 240  Q
          ||||||||||||||||||||||||||||||||||||||||||||||||    
38946838 aaaaaagataacaaaatccctacaacatccagggccatcatcaaccgccttcgt 38946891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 91 - 167
Target Start/End: Original strand, 42093600 - 42093676
Alignment:
91 gacacattttgtatcaattttttgaactatgattgttgacttgttgttgggaaggaaaatgataatggatggtcttt 167  Q
    ||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
42093600 gacacgttttgtatcaattttttgaactatgtttgttgacttgttgttgggaaggaaaatgataatggatggtcttt 42093676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 196 - 240
Target Start/End: Complemental strand, 45204185 - 45204141
Alignment:
196 aacaaaatccctacaacatccagggccatcatcaaccgccttcgt 240  Q
    |||||||| |||||| |||||||||||||| ||||||||||||||    
45204185 aacaaaattcctacagcatccagggccatcctcaaccgccttcgt 45204141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University