View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0497_low_9 (Length: 338)
Name: NF0497_low_9
Description: NF0497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0497_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 87 - 240
Target Start/End: Original strand, 38946738 - 38946891
Alignment:
| Q |
87 |
cacagacacattttgtatcaattttttgaactatgattgttgacttgttgttgggaaggaaaatgataatggatggtctttgttcatnnnnnnnnnnnnn |
186 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38946738 |
cacagatacattttgtatcaatcttttgaactatgattgttgacttgttgttgggaaggaaaatgataatggatggtctctgttcataaaaaataaaata |
38946837 |
T |
|
| Q |
187 |
nnnnnngataacaaaatccctacaacatccagggccatcatcaaccgccttcgt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38946838 |
aaaaaagataacaaaatccctacaacatccagggccatcatcaaccgccttcgt |
38946891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 91 - 167
Target Start/End: Original strand, 42093600 - 42093676
Alignment:
| Q |
91 |
gacacattttgtatcaattttttgaactatgattgttgacttgttgttgggaaggaaaatgataatggatggtcttt |
167 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42093600 |
gacacgttttgtatcaattttttgaactatgtttgttgacttgttgttgggaaggaaaatgataatggatggtcttt |
42093676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 196 - 240
Target Start/End: Complemental strand, 45204185 - 45204141
Alignment:
| Q |
196 |
aacaaaatccctacaacatccagggccatcatcaaccgccttcgt |
240 |
Q |
| |
|
|||||||| |||||| |||||||||||||| |||||||||||||| |
|
|
| T |
45204185 |
aacaaaattcctacagcatccagggccatcctcaaccgccttcgt |
45204141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1617 times since January 2019
Visitors: 3460