View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0498_high_25 (Length: 251)
Name: NF0498_high_25
Description: NF0498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0498_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 21 - 167
Target Start/End: Original strand, 37620011 - 37620157
Alignment:
| Q |
21 |
taaaattataaatgacatatttttgtcatggaccttattgtttattatatataagactgcagtcttatggctaagtagaaataatgctacaagaattatg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37620011 |
taaaattataaatgacatatttttgtcatggaccttattgtttattatataaaagactgcagtcttatggctaagtagaaataatgctacaagaattatg |
37620110 |
T |
|
| Q |
121 |
aactattttgtttagcttgggaggaattaaccagtaaccaccatatt |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37620111 |
aactattttgtttagcttgggaggaattaaccagtaaccaccatatt |
37620157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 166 - 227
Target Start/End: Original strand, 37620208 - 37620269
Alignment:
| Q |
166 |
ttaacaagagcaaaattggtatacctctatgaaattgataagggacacaatcttttttgatg |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
37620208 |
ttaacaagagcaaaattggtatacctctatgaaattgataagggatgcgatcttttttgatg |
37620269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1 times since January 2019
Visitors: 3463