View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0498_high_7 (Length: 415)
Name: NF0498_high_7
Description: NF0498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0498_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 271 - 326
Target Start/End: Original strand, 18095576 - 18095631
Alignment:
| Q |
271 |
aacctcgattctttctagtttattcgaatttctttctgatttttgactctgttttt |
326 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18095576 |
aacctcgattctttctagtttcttcgaatttctttctgatttttgactctgttttt |
18095631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 162 times since January 2019
Visitors: 3464