View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0498_high_7 (Length: 415)

Name: NF0498_high_7
Description: NF0498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0498_high_7
NF0498_high_7
[»] chr5 (1 HSPs)
chr5 (271-326)||(18095576-18095631)


Alignment Details
Target: chr5 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 271 - 326
Target Start/End: Original strand, 18095576 - 18095631
Alignment:
271 aacctcgattctttctagtttattcgaatttctttctgatttttgactctgttttt 326  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
18095576 aacctcgattctttctagtttcttcgaatttctttctgatttttgactctgttttt 18095631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University