View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0498_low_16 (Length: 339)
Name: NF0498_low_16
Description: NF0498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0498_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 91 - 244
Target Start/End: Complemental strand, 32582461 - 32582308
Alignment:
Q |
91 |
tcaaggaggaggtggtggtggaagaagcgtcatcgccggtggttgggaagttgtgcagcggttgtggagaaagggagtcagtagtgctgttactgccatg |
190 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
32582461 |
tcaaggaggaggtggtggtggaagaagcgtcatcgccggtggttgggaagttgtgcagcggttgtggggaaagggagtcagtagtgctgttactgccatg |
32582362 |
T |
 |
Q |
191 |
taggcatttgtgtttgtgtacaatgtgtgggacccacattcgtaattgccctct |
244 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32582361 |
taggcatttgtgtttgtgtacaatgtgtgggacccacattcgtaattgccctct |
32582308 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University