View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0498_low_16 (Length: 339)

Name: NF0498_low_16
Description: NF0498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0498_low_16
NF0498_low_16
[»] chr4 (1 HSPs)
chr4 (91-244)||(32582308-32582461)


Alignment Details
Target: chr4 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 91 - 244
Target Start/End: Complemental strand, 32582461 - 32582308
Alignment:
Q  91 tcaaggaggaggtggtggtggaagaagcgtcatcgccggtggttgggaagttgtgcagcggttgtggagaaagggagtcagtagtgctgttactgccatg 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  32582461 tcaaggaggaggtggtggtggaagaagcgtcatcgccggtggttgggaagttgtgcagcggttgtggggaaagggagtcagtagtgctgttactgccatg 32582362  T
Q  191 taggcatttgtgtttgtgtacaatgtgtgggacccacattcgtaattgccctct 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32582361 taggcatttgtgtttgtgtacaatgtgtgggacccacattcgtaattgccctct 32582308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University