View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0498_low_24 (Length: 307)
Name: NF0498_low_24
Description: NF0498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0498_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 9e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 114 - 260
Target Start/End: Original strand, 17355838 - 17355984
Alignment:
| Q |
114 |
tcatatttgttttttgggcttatgtttcttgattttcttttaagaaagaacaagatcttgtattggtatggctaccattacaaatcttgtgggtcatatc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
17355838 |
tcatatttgttttttgggcttatgtttcttgattttcttttaagaaagaacaagatcttgtattggtatggctaccattacaaatcttatgggtcttatc |
17355937 |
T |
 |
| Q |
214 |
tttcatttcttgatcaattgtcgtgaatcgttgattagatcgaacta |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17355938 |
tttcatttcttgatcaattgtcgtgaatcgttgattagatcgaacta |
17355984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University