View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0498_low_35 (Length: 248)
Name: NF0498_low_35
Description: NF0498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0498_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 43101896 - 43101672
Alignment:
Q |
1 |
gccaggtgtggcggcgaatgtgaaccttggtgctttctatatggtggggatgccaatggcggtagtacttgcgttttggtttgacgttgggtttcgtggg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
43101896 |
gccaggtgtggcggcgaatgtgaaccttggtgctttctatatggtggggatgccaatggcggtagtgcttgcgttttggtttgacgttgggtttcgtggg |
43101797 |
T |
 |
Q |
101 |
ctttggttgggtttgctctcggcccaggtttgttgtgctgggttcatgttgtatgtgattgcgatcactgattgggattttgaagctatgcgggcccact |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43101796 |
ctttggttgggtttgctctcggcccaggtttgttgtgctgggttcatgttgtatgtgattgcgatcactgattgggattttgaagctatgcgggcccact |
43101697 |
T |
 |
Q |
201 |
ttcttacttgtgtgtgtagtgatgatg |
227 |
Q |
|
|
| ||||||||| |||||||||||||| |
|
|
T |
43101696 |
tgcttacttgt--gtgtagtgatgatg |
43101672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 8 - 138
Target Start/End: Original strand, 33949612 - 33949742
Alignment:
Q |
8 |
gtggcggcgaatgtgaaccttggtgctttctatatggtggggatgccaatggcggtagtacttgcgttttggtttgacgttgggtttcgtgggctttggt |
107 |
Q |
|
|
|||||||| |||||||| | ||||||| ||||||||||| |||||| |||| || | ||||| ||||||||||| |||| ||| | |||||||||| |
|
|
T |
33949612 |
gtggcggcaaatgtgaatttgagtgctttttatatggtgggaatgccagtggcagttgggcttgctttttggtttgattttggattttgcgggctttggt |
33949711 |
T |
 |
Q |
108 |
tgggtttgctctcggcccaggtttgttgtgc |
138 |
Q |
|
|
|||| | || || ||||||||||||||||| |
|
|
T |
33949712 |
tgggccttctatcagcccaggtttgttgtgc |
33949742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University