View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0499_high_6 (Length: 277)
Name: NF0499_high_6
Description: NF0499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0499_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 46 - 234
Target Start/End: Original strand, 4665479 - 4665667
Alignment:
Q |
46 |
gacatcatcaattcaatgtgggctgtggcgttatttatgttcatagtttaggatagtagtaaagtcattagatgctgatatcattatcttggtcttcgaa |
145 |
Q |
|
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4665479 |
gacatcataaattcaatgtgggctgtggtgttatttatgttcatagtttaggatagtagtaaagtcattagatgctgatatcattatcttggtcttcgaa |
4665578 |
T |
 |
Q |
146 |
agattgaattaatttttctagtctctgcagtaacaaaaaatccagtccaattctaaaaagctgtggcattaatttagtttctttgatct |
234 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4665579 |
agattgagttaatttttctagtctctgcagtaacaaaaaatctagtccaattctaaaaagctgtggcattaatttagtttctttgatct |
4665667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 552 times since January 2019
Visitors: 3483