View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0499_low_4 (Length: 342)
Name: NF0499_low_4
Description: NF0499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0499_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 21 - 332
Target Start/End: Complemental strand, 34167152 - 34166841
Alignment:
| Q |
21 |
acatcatcatgcctaggacgcaacattttagtttgtacctttactgatgggtnnnnnnnncacatttatcaggttataatatcatcctaggtttgagtct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34167152 |
acatcatcatgcctaggacgcaacattttagtttgtacctttactgatgggtaaaaaaaacacatttatcaggttataatatcatcctaggtttgagtct |
34167053 |
T |
|
| Q |
121 |
aagtcgtccccgacaaactggcttaaatgctgaggattgtctaccctttataagcnnnnnnnnagtccatttctctagtaggatcacgacaaccttctaa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34167052 |
aagtcgtccccgacaaactggcttaaatgctgaggattgtctaccctttataagcttttttttagtccatttctctagtaggatcacgacaaccttctaa |
34166953 |
T |
|
| Q |
221 |
tttcactcaagaaataaattacgtcattggaaagtttaattagctaaaaattcataagttggacatactctcccagtgtagagctaaaagttccagactc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34166952 |
tttcactcaagaaataaattacgtcattggaaagtttaattagctaaaaattcataagttggacatactctcccagtgtagagctaaaagttccagactc |
34166853 |
T |
|
| Q |
321 |
ttgcattctctg |
332 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34166852 |
ttgcattctctg |
34166841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1708 times since January 2019
Visitors: 3461