View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0499_low_8 (Length: 268)
Name: NF0499_low_8
Description: NF0499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0499_low_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 79 - 268
Target Start/End: Complemental strand, 25794438 - 25794250
Alignment:
| Q |
79 |
ggagcagagagggagtgttggtccttattttgtaaattttttgtatcagctcttatattatagccaatcaaagagatttctgactcattgagaatttaca |
178 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25794438 |
ggagcaaaaagggagtgttggtccttattttgtaaattttt-gtatcagctcttatattatagccaatcaaagagatttctgactcattgagaatttaca |
25794340 |
T |
 |
| Q |
179 |
acagaatttacagataacctaccaagtatggaattttggactcaaacctaagttgtaatccgtatgagaggaaagtcttaccatgtgtgc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25794339 |
acagaatttacagataacctaccaagtatggaattttggactcaaacccaagttgtaatccgtatgagaggaaagtcttaccatgtgtgc |
25794250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University